Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0000096 | |||
Gene | HIAT1 | Organism | Human |
Genome Locus | chr1:100515464-100535241:+ | Build | hg19 |
Disease | Gastric Cancer | ICD-10 | Stomach, Malignant neoplasm of unspecified (C16.9) |
DBLink | Link to database | PMID | 28081541 |
Experimental Method | |||
Sample Type | Tissues | Comparison | 101 paired gastric cancer tissues and adjacent non-tumorous tissues |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CAGTCCTTGGCATTCTTTCC ReverseGTGGGTGCTGTCAATAGTCC | Statistics | Fold Change : Downregulated pvalue : p<0.001 |
Citation | |||
Li, P, Chen, H, Chen, S, Mo, X, Li, T, Xiao, B, Yu, R, Guo, J (2017). Circular RNA 0000096 affects cell growth and migration in gastric cancer. Br. J. Cancer, 116, 5:626-633. |